Skip to main content

Table 1 The 10 shRNAs

From: Multiple shRNA combinations for near-complete coverage of all HIV-1 strains

#a Target -2 -1b 19 nt. core + 1/2 nt.c Loopd T.e Bf ALLg
0 LTR 510-21 AA CCCACTGCTTAAGCCTCAATA A CTCGAGA   100 70
1 LTR 527-21 TC AATAAAGCTTGCCTTGAGTGC A CTCGAGA G 100 93
2 Gag 533-20 AG GAGCCACCCCACAAGATTTA T CTCGAGT   80 70
3 Pol 248-20 AG GAGCAGATGATACAGTATTA C CTCGAGC   87 80
4 Pol 2670-21 GC AGTACAAATGGCAGTATTCAT A CTCGAGA G 74 73
5 Pol 2878-20 AA GGTGAAGGGGCAGTAGTAAT T CTCGAGT   80 74
6 Vif 9-21 AA CAGATGGCAGGTGATGATTGT A CTCGAGA   92 71
7 Tat (x1) 140-21 CT ATGGCAGGAAGAAGCGGAGAC A CTCGAGA A 77 73
8 Vpu 143-20 AA GAGCAGAAGACAGTGGCAAT C CTCGAGC   83 66
9 Env 1428-21 AA TTGGAGAAGTGAATTATATAA A CTCGAGA   81 73
  1. a shRNA reference number (#) used in this study.
  2. b The two nt. immediately upstream of the 19 bp core target site were taken into consideration when estimating individual shRNA conservations but not included in the shRNA stem, nor used in calculating intersecting conservations.
  3. c The shRNAs had 20 or 21 bp stems built around a 19 bp core placed at the base terminus of the shRNA which was extended by 1 or 2 nt. with target matched sequence at the loop terminus, as indicated in bold (and used when estimating individual shRNA conservations).
  4. d If the core was made into a 20 bp hairpin stem, then the last nucleotide of the loop was selected to be the complement of the last nucleotide of the p+2 position so that if the processed siRNA product(s) included the the last nucleotide of the loop then it too would be matched to the target (indicated by underline).
  5. e The shRNAs in which the last base of the anti-sense stem was 'T' also included a 'termination spacer' so as to prevent premature termination via an early run of 'T's. This nucleotide was always the complement of the first nucleotide of the p-1 position (but never a 'T'), so that if included in the processed siRNA product(s) it was also matched to the target.
  6. f % conservation for the 19 bp core in LANL clade B sequences only.
  7. g % conservation for the 19 bp core in ALL LANL sequences, irrespective of clade.